My First Post

This is my first lab notebook post using GitHub’s markdown.

My goals today are to:

  1. Get my first lab notebook post out
  2. Start on my first task to familiarize with the lab’s general DNA methylation analysis pipeline for PE bisulfite sequencing data
  3. Try to find a monitor and keyboard from the surplus room in SAFS

This is an example of how to include images in posts and of how much I love shellfish an image alt text

Let’s see how this goes!

End-of-day Update:

  1. Post worked!
  2. Progress on first task:
    • Got server credentials and was able to mount servers to access data
    • Set up jupyter notebook. Found this tutorial helpful. Still need to work on how to sync with GitHub so large data files and analyses can be saved on the server.
    • Was able to download Bismark and get it to run locally on a subset of the data (10K reads). See details below. I did not do further analysis because I wanted to get the jupyter notebook fully set up and run the analysis on the server before getting too deep. -will continue to work on jupyter notebook setup and analysis tomorrow
  3. Went down to SAFS to ask Laurie about the surplus room, but she was in a meeting. Will try tomorrow

####################RUNNING BISMARK LOCALLY##################################### ##needed to install bowtie2 locally conda install -c bioconda bowtie2 ##needed to install samtools locally conda install -c bioconda samtools ##install bismark conda install -c bioconda bismark ##download genome locally curl http://owl.fish.washington.edu/halfshell/genomic-databank/Cvirginica_v300.fa > Cvirginica_v300.fa

##bismark genome preparation bismark_genome_preparation –path_to_bowtie /Users/Shelly/anaconda3/bin/ –verbose /Users/Shelly/Desktop/personal/Career/StevenRobetsLab/GENOMES/Cvirginica/v300 ###output from command => see below

#running bismark bismark -u 10000 –non_directional –score_min L,0,-0.6 –genome /Users/Shelly/Desktop/personal/Career/StevenRobetsLab/GENOMES/Cvirginica/v300/ -1 /Volumes/web/seashell/bu-serine-wd/18-04-07/R1.fastq.gz -2 /Volumes/web/seashell/bu-serine-wd/18-04-07/R2.fastq.gz

###############output from bismark alignment#######################

Path to Bowtie 2 specified as: bowtie2

Bowtie seems to be working fine (tested command ‘bowtie2 –version’ [2.3.4])

Output format is BAM (default)

Alignments will be written out in BAM format. Samtools found here: ‘/Users/Shelly/anaconda3/bin/samtools’

Reference genome folder provided is /Users/Shelly/Desktop/personal/Career/StevenRobetsLab/GENOMES/Cvirginica/v300/ (absolute path is ‘/Users/Shelly/Desktop/personal/Career/StevenRobetsLab/GENOMES/Cvirginica/v300/)’

FastQ format assumed (by default)

Processing sequences up to read no. 10000 from the input file

Input files to be analysed (in current folder ‘/Users/Shelly/Desktop/personal/Career/StevenRobetsLab/data_analysis/Cvirg_Apr2018/Bismark_attempt1’):

/Volumes/web/seashell/bu-serine-wd/18-04-07/zr2096_1_s1_R1.fastq.gz

/Volumes/web/seashell/bu-serine-wd/18-04-07/zr2096_1_s1_R2.fastq.gz

Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!)

Setting parallelization to single-threaded (default)

Current working directory is: /Users/Shelly/Desktop/personal/Career/StevenRobetsLab/data_analysis/Cvirg_Apr2018/Bismark_attempt1

Now reading in and storing sequence information of the genome specified in: /Users/Shelly/Desktop/personal/Career/StevenRobetsLab/GENOMES/Cvirginica/v300/

chr NC_035780.1 (65668440 bp)

chr NC_035781.1 (61752955 bp)

chr NC_035782.1 (77061148 bp)

chr NC_035783.1 (59691872 bp)

chr NC_035784.1 (98698416 bp)

chr NC_035785.1 (51258098 bp)

chr NC_035786.1 (57830854 bp)

chr NC_035787.1 (75944018 bp)

chr NC_035788.1 (104168038 bp)

chr NC_035789.1 (32650045 bp)

chr NC_007175.2 (17244 bp)

Single-core mode: setting pid to 1

Paired-end alignments will be performed

=======================================

The provided filenames for paired-end alignments are /Volumes/web/seashell/bu-serine-wd/18-04-07/zr2096_1_s1_R1.fastq.gz and /Volumes/web/seashell/bu-serine-wd/18-04-07/zr2096_1_s1_R2.fastq.gz

Input files are in FastQ format

Processing reads up to sequence no. 10000 from /Volumes/web/seashell/bu-serine-wd/18-04-07/zr2096_1_s1_R1.fastq.gz

Writing a C -> T converted version of the input file zr2096_1_s1_R1.fastq.gz to zr2096_1_s1_R1.fastq.gz_C_to_T.fastq

Created C -> T converted version of the FastQ file zr2096_1_s1_R1.fastq.gz (10001 sequences in total)

Processing reads up to sequence no. 10000 from /Volumes/web/seashell/bu-serine-wd/18-04-07/zr2096_1_s1_R2.fastq.gz

Writing a G -> A converted version of the input file zr2096_1_s1_R2.fastq.gz to zr2096_1_s1_R2.fastq.gz_G_to_A.fastq

Created G -> A converted version of the FastQ file zr2096_1_s1_R2.fastq.gz (10001 sequences in total)

Input files are zr2096_1_s1_R1.fastq.gz_C_to_T.fastq and zr2096_1_s1_R2.fastq.gz_G_to_A.fastq (FastQ)

Now running 2 instances of Bowtie 2 against the bisulfite genome of /Users/Shelly/Desktop/personal/Career/StevenRobetsLab/GENOMES/Cvirginica/v300/ with the specified options: -q –score-min L,0,-0.2 –ignore-quals –no-mixed –no-discordant –dovetail –maxins 500

Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from zr2096_1_s1_R1.fastq.gz_C_to_T.fastq and zr2096_1_s1_R2.fastq.gz_G_to_A.fastq, with the options: -q –score-min L,0,-0.2 –ignore-quals –no-mixed –no-discordant –dovetail –maxins 500 –norc))

Found first alignment:

HWI-C00124:321:CC781ANXX:1:1101:1249:2156_1:N:0:CGATGT/1 77 * 0 0 * * 0 GAGTTTTTTTGATTATTTGTTGTTTGTTGTTTGTTTGNNNNTNNNTNNGTTTGTTTGTTTGTTTGTTTGTTTGTAAATTTTTTATATTTTTATTTTTTTT BBBBBFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF####<###<##«<FFFFFFFFFFFFFFFF<FFFFFF/</FFFFFF/B/FFFFF/FFFFFFFF YT:Z:UP

HWI-C00124:321:CC781ANXX:1:1101:1249:2156_2:N:0:CGATGT/2 141 * 0 0 * * 0 CCCCTTAAAAAAAAACAAAACCCTTCATTCAAACAAACTTAAATCCCCTTCACCTAAAAATACTTTATATCAAATTTAATTAAAATTAACCCAATAATTC BBBBBFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF YT:Z:UP

Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from zr2096_1_s1_R1.fastq.gz_C_to_T.fastq and zr2096_1_s1_R2.fastq.gz_G_to_A.fastq, with the options: -q –score-min L,0,-0.2 –ignore-quals –no-mixed –no-discordant –dovetail –maxins 500 –nofw))

Found first alignment:

HWI-C00124:321:CC781ANXX:1:1101:1249:2156_1:N:0:CGATGT/1 77 * 0 0 * * 0 GAGTTTTTTTGATTATTTGTTGTTTGTTGTTTGTTTGNNNNTNNNTNNGTTTGTTTGTTTGTTTGTTTGTTTGTAAATTTTTTATATTTTTATTTTTTTT BBBBBFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF####<###<##«<FFFFFFFFFFFFFFFF<FFFFFF/</FFFFFF/B/FFFFF/FFFFFFFF YT:Z:UP

HWI-C00124:321:CC781ANXX:1:1101:1249:2156_2:N:0:CGATGT/2 141 * 0 0 * * 0 CCCCTTAAAAAAAAACAAAACCCTTCATTCAAACAAACTTAAATCCCCTTCACCTAAAAATACTTTATATCAAATTTAATTAAAATTAACCCAATAATTC BBBBBFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF YT:Z:UP

»> Writing bisulfite mapping results to zr2096_1_s1_R1_bismark_bt2_pe.bam «<

Reading in the sequence files /Volumes/web/seashell/bu-serine-wd/18-04-07/zr2096_1_s1_R1.fastq.gz and /Volumes/web/seashell/bu-serine-wd/18-04-07/zr2096_1_s1_R2.fastq.gz

10000 reads; of these:

10000 (100.00%) were paired; of these:

9720 (97.20%) aligned concordantly 0 times

163 (1.63%) aligned concordantly exactly 1 time

117 (1.17%) aligned concordantly >1 times

2.80% overall alignment rate

10000 reads; of these:

10000 (100.00%) were paired; of these:

9717 (97.17%) aligned concordantly 0 times

163 (1.63%) aligned concordantly exactly 1 time

120 (1.20%) aligned concordantly >1 times

2.83% overall alignment rate

Processed 10000 sequences in total

Successfully deleted the temporary files zr2096_1_s1_R1.fastq.gz_C_to_T.fastq and zr2096_1_s1_R2.fastq.gz_G_to_A.fastq

Final Alignment report

======================

Sequence pairs analysed in total: 10000

Number of paired-end alignments with a unique best hit: 298

Mapping efficiency: 3.0%

Sequence pairs with no alignments under any condition: 9562

Sequence pairs did not map uniquely: 140

Sequence pairs which were discarded because genomic sequence could not be extracted: 0

Number of sequence pairs with unique best (first) alignment came from the bowtie output:

CT/GA/CT: 152 ((converted) top strand)

GA/CT/CT: 0 (complementary to (converted) top strand)

GA/CT/GA: 0 (complementary to (converted) bottom strand)

CT/GA/GA: 146 ((converted) bottom strand)

Number of alignments to (merely theoretical) complementary strands being rejected in total: 0

Final Cytosine Methylation Report

=================================

Total number of C’s analysed: 10572

Total methylated C’s in CpG context: 1191

Total methylated C’s in CHG context: 48

Total methylated C’s in CHH context: 117

Total methylated C’s in Unknown context: 0

Total unmethylated C’s in CpG context: 295

Total unmethylated C’s in CHG context: 2453

Total unmethylated C’s in CHH context: 6468

Total unmethylated C’s in Unknown context: 13

C methylated in CpG context: 80.1%

C methylated in CHG context: 1.9%

C methylated in CHH context: 1.8%

C methylated in unknown context (CN or CHN): 0.0%

Bismark completed in 0d 0h 0m 51s

====================

Bismark run complete

====================

###############output from bismark genome preparation####################### #Path to genome folder specified as: /Users/Shelly/Desktop/personal/Career/StevenRobetsLab/GENOMES/Cvirginica/v300/ #Aligner to be used: Bowtie 2 (default) #Writing bisulfite genomes out into a single MFA (multi FastA) file

#Bismark Genome Preparation - Step I: Preparing folders

#Path to Bowtie 2 specified: /Users/Shelly/anaconda3/bin/

Bisulfite Genome Indexer version v0.20.0 (last modified 26 April 2018)

Created Bisulfite Genome folder /Users/Shelly/Desktop/personal/Career/StevenRobetsLab/GENOMES/Cvirginica/v300/Bisulfite_Genome/

Created Bisulfite Genome folder /Users/Shelly/Desktop/personal/Career/StevenRobetsLab/GENOMES/Cvirginica/v300/Bisulfite_Genome/CT_conversion/

Created Bisulfite Genome folder /Users/Shelly/Desktop/personal/Career/StevenRobetsLab/GENOMES/Cvirginica/v300/Bisulfite_Genome/GA_conversion/

Step I - Prepare genome folders - completed

Bismark Genome Preparation - Step II: Bisulfite converting reference genome

conversions performed:

chromosome C->T G->A

NC_035780.1 11492316 11528162

NC_035781.1 10879823 10858285

NC_035782.1 13475475 13496235

NC_035783.1 10484268 10482193

NC_035784.1 17306783 17253434

NC_035785.1 8878985 8876470

NC_035786.1 9961761 9989843

NC_035787.1 13145205 13164212

NC_035788.1 17925605 17932896

NC_035789.1 5676071 5682065

NC_007175.2 2827 3882

Total number of conversions performed:

C->T: 119229119

G->A: 119267677

Step II - Genome bisulfite conversions - completed

Bismark Genome Preparation - Step III: Launching the Bowtie 2 indexer

Please be aware that this process can - depending on genome size - take several hours!

Preparing indexing of CT converted genome in /Users/Shelly/Desktop/personal/Career/StevenRobetsLab/GENOMES/Cvirginica/v300/Bisulfite_Genome/CT_conversion/

Parent process: Starting to index C->T converted genome with the following command:

/Users/Shelly/anaconda3/bin/bowtie2-build -f genome_mfa.CT_conversion.fa BS_CT

Settings:

Output files: “BS_CT.*.bt2”

Line rate: 6 (line is 64 bytes)

Lines per side: 1 (side is 64 bytes)

Offset rate: 4 (one in 16)

FTable chars: 10

Strings: unpacked

Max bucket size: default

Max bucket size, sqrt multiplier: default

Max bucket size, len divisor: 4

Difference-cover sample period: 1024

Endianness: little

Actual local endianness: little

Sanity checking: disabled

Assertions: disabled

Random seed: 0

Sizeofs: void*:8, int:4, long:8, size_t:8

Input files DNA, FASTA:

genome_mfa.CT_conversion.fa

Building a SMALL index

Reading reference sizes

Preparing indexing of GA converted genome in /Users/Shelly/Desktop/personal/Career/StevenRobetsLab/GENOMES/Cvirginica/v300/Bisulfite_Genome/GA_conversion/

Child process: Starting to index G->A converted genome with the following command:

/Users/Shelly/anaconda3/bin/bowtie2-build -f genome_mfa.GA_conversion.fa BS_GA

Settings:

Output files: “BS_GA.*.bt2”

Line rate: 6 (line is 64 bytes)

Lines per side: 1 (side is 64 bytes)

Offset rate: 4 (one in 16)

FTable chars: 10

Strings: unpacked

Max bucket size: default

Max bucket size, sqrt multiplier: default

Max bucket size, len divisor: 4

Difference-cover sample period: 1024

Endianness: little

Actual local endianness: little

Sanity checking: disabled

Assertions: disabled

Random seed: 0

Sizeofs: void*:8, int:4, long:8, size_t:8

Input files DNA, FASTA:

genome_mfa.GA_conversion.fa

Building a SMALL index

Reading reference sizes

Time reading reference sizes: 00:00:11

Calculating joined length

Writing header

Reserving space for joined string

Joining reference sequences

Time reading reference sizes: 00:00:11

Calculating joined length

Writing header

Reserving space for joined string

Joining reference sequences

Time to join reference sequences: 00:00:07

bmax according to bmaxDivN setting: 171168832

Using parameters –bmax 128376624 –dcv 1024

Doing ahead-of-time memory usage test

Passed! Constructing with these parameters: –bmax 128376624 –dcv 1024

Constructing suffix-array element generator

Building DifferenceCoverSample

Building sPrime

Building sPrimeOrder

V-Sorting samples

Time to join reference sequences: 00:00:07

bmax according to bmaxDivN setting: 171168832

Using parameters –bmax 128376624 –dcv 1024

Doing ahead-of-time memory usage test

Passed! Constructing with these parameters: –bmax 128376624 –dcv 1024

Constructing suffix-array element generator

Building DifferenceCoverSample

Building sPrime

Building sPrimeOrder

V-Sorting samples

V-Sorting samples time: 00:00:25

Allocating rank array

Ranking v-sort output

V-Sorting samples time: 00:00:25

Allocating rank array

Ranking v-sort output

Ranking v-sort output time: 00:00:07

Invoking Larsson-Sadakane on ranks

Ranking v-sort output time: 00:00:07

Invoking Larsson-Sadakane on ranks

Invoking Larsson-Sadakane on ranks time: 00:00:09

Sanity-checking and returning

Building samples

Reserving space for 12 sample suffixes

Generating random suffixes

QSorting 12 sample offsets, eliminating duplicates

QSorting sample offsets, eliminating duplicates time: 00:00:00

Multikey QSorting 12 samples

(Using difference cover)

Multikey QSorting samples time: 00:00:00

Calculating bucket sizes

Splitting and merging

Splitting and merging time: 00:00:00

Avg bucket size: 6.84675e+08 (target: 128376623)

Converting suffix-array elements to index image

Allocating ftab, absorbFtab

Entering Ebwt loop

Getting block 1 of 1

No samples; assembling all-inclusive block

Invoking Larsson-Sadakane on ranks time: 00:00:10

Sanity-checking and returning

Building samples

Reserving space for 12 sample suffixes

Generating random suffixes

QSorting 12 sample offsets, eliminating duplicates

QSorting sample offsets, eliminating duplicates time: 00:00:00

Multikey QSorting 12 samples

(Using difference cover)

Multikey QSorting samples time: 00:00:00

Calculating bucket sizes

Splitting and merging

Splitting and merging time: 00:00:00

Avg bucket size: 6.84675e+08 (target: 128376623)

Converting suffix-array elements to index image

Allocating ftab, absorbFtab

Entering Ebwt loop

Getting block 1 of 1

No samples; assembling all-inclusive block

Sorting block of length 684675328 for bucket 1

(Using difference cover)

Sorting block of length 684675328 for bucket 1

(Using difference cover)

Sorting block time: 00:11:05

Returning block of 684675329 for bucket 1

Exited Ebwt loop

fchr[A]: 0

fchr[C]: 342402452

fchr[G]: 461631571

fchr[T]: 461631571

fchr[$]: 684675328

Exiting Ebwt::buildToDisk()

Returning from initFromVector

Wrote 232427948 bytes to primary EBWT file: BS_GA.1.bt2

Wrote 171168840 bytes to secondary EBWT file: BS_GA.2.bt2

Re-opening _in1 and _in2 as input streams

Returning from Ebwt constructor

Headers:

len: 684675328

bwtLen: 684675329

sz: 171168832

bwtSz: 171168833

lineRate: 6

offRate: 4

offMask: 0xfffffff0

ftabChars: 10

eftabLen: 20

eftabSz: 80

ftabLen: 1048577

ftabSz: 4194308

offsLen: 42792209

offsSz: 171168836

lineSz: 64

sideSz: 64

sideBwtSz: 48

sideBwtLen: 192

numSides: 3566018

numLines: 3566018

ebwtTotLen: 228225152

ebwtTotSz: 228225152

color: 0

reverse: 0

Total time for call to driver() for forward index: 00:14:20

Reading reference sizes

Sorting block time: 00:13:18

Returning block of 684675329 for bucket 1

Time reading reference sizes: 00:00:09

Calculating joined length

Writing header

Reserving space for joined string

Joining reference sequences

Time to join reference sequences: 00:00:07

Time to reverse reference sequence: 00:00:00

bmax according to bmaxDivN setting: 171168832

Using parameters –bmax 128376624 –dcv 1024

Doing ahead-of-time memory usage test

Passed! Constructing with these parameters: –bmax 128376624 –dcv 1024

Constructing suffix-array element generator

Building DifferenceCoverSample

Building sPrime

Building sPrimeOrder

V-Sorting samples

V-Sorting samples time: 00:00:29

Allocating rank array

Ranking v-sort output

Ranking v-sort output time: 00:00:07

Invoking Larsson-Sadakane on ranks

Invoking Larsson-Sadakane on ranks time: 00:00:11

Sanity-checking and returning

Building samples

Reserving space for 12 sample suffixes

Generating random suffixes

QSorting 12 sample offsets, eliminating duplicates

QSorting sample offsets, eliminating duplicates time: 00:00:00

Multikey QSorting 12 samples

(Using difference cover)

Multikey QSorting samples time: 00:00:00

Calculating bucket sizes

Splitting and merging

Splitting and merging time: 00:00:00

Avg bucket size: 6.84675e+08 (target: 128376623)

Converting suffix-array elements to index image

Allocating ftab, absorbFtab

Entering Ebwt loop

Getting block 1 of 1

No samples; assembling all-inclusive block

Sorting block of length 684675328 for bucket 1

(Using difference cover)

Exited Ebwt loop

fchr[A]: 0

fchr[C]: 223134775

fchr[G]: 223134775

fchr[T]: 342402452

fchr[$]: 684675328

Exiting Ebwt::buildToDisk()

Returning from initFromVector

Wrote 232427948 bytes to primary EBWT file: BS_CT.1.bt2

Wrote 171168840 bytes to secondary EBWT file: BS_CT.2.bt2

Re-opening _in1 and _in2 as input streams

Returning from Ebwt constructor

Headers:

len: 684675328

bwtLen: 684675329

sz: 171168832

bwtSz: 171168833

lineRate: 6

offRate: 4

offMask: 0xfffffff0

ftabChars: 10

eftabLen: 20

eftabSz: 80

ftabLen: 1048577

ftabSz: 4194308

offsLen: 42792209

offsSz: 171168836

lineSz: 64

sideSz: 64

sideBwtSz: 48

sideBwtLen: 192

numSides: 3566018

numLines: 3566018

ebwtTotLen: 228225152

ebwtTotSz: 228225152

color: 0

reverse: 0

Total time for call to driver() for forward index: 00:16:36

Reading reference sizes

Time reading reference sizes: 00:00:09

Calculating joined length

Writing header

Reserving space for joined string

Joining reference sequences

Time to join reference sequences: 00:00:07

Time to reverse reference sequence: 00:00:01

bmax according to bmaxDivN setting: 171168832

Using parameters –bmax 128376624 –dcv 1024

Doing ahead-of-time memory usage test

Passed! Constructing with these parameters: –bmax 128376624 –dcv 1024

Constructing suffix-array element generator

Building DifferenceCoverSample

Building sPrime

Building sPrimeOrder

V-Sorting samples

V-Sorting samples time: 00:00:26

Allocating rank array

Ranking v-sort output

Ranking v-sort output time: 00:00:07

Invoking Larsson-Sadakane on ranks

Invoking Larsson-Sadakane on ranks time: 00:00:10

Sanity-checking and returning

Building samples

Reserving space for 12 sample suffixes

Generating random suffixes

QSorting 12 sample offsets, eliminating duplicates

QSorting sample offsets, eliminating duplicates time: 00:00:00

Multikey QSorting 12 samples

(Using difference cover)

Multikey QSorting samples time: 00:00:00

Calculating bucket sizes

Splitting and merging

Splitting and merging time: 00:00:00

Avg bucket size: 6.84675e+08 (target: 128376623)

Converting suffix-array elements to index image

Allocating ftab, absorbFtab

Entering Ebwt loop

Getting block 1 of 1

No samples; assembling all-inclusive block

Sorting block of length 684675328 for bucket 1

(Using difference cover)

Sorting block time: 00:11:47

Returning block of 684675329 for bucket 1

Exited Ebwt loop

fchr[A]: 0

fchr[C]: 342402452

fchr[G]: 461631571

fchr[T]: 461631571

fchr[$]: 684675328

Exiting Ebwt::buildToDisk()

Returning from initFromVector

Wrote 232427948 bytes to primary EBWT file: BS_GA.rev.1.bt2

Wrote 171168840 bytes to secondary EBWT file: BS_GA.rev.2.bt2

Re-opening _in1 and _in2 as input streams

Returning from Ebwt constructor

Headers:

len: 684675328

bwtLen: 684675329

sz: 171168832

bwtSz: 171168833

lineRate: 6

offRate: 4

offMask: 0xfffffff0

ftabChars: 10

eftabLen: 20

eftabSz: 80

ftabLen: 1048577

ftabSz: 4194308

offsLen: 42792209

offsSz: 171168836

lineSz: 64

sideSz: 64

sideBwtSz: 48

sideBwtLen: 192

numSides: 3566018

numLines: 3566018

ebwtTotLen: 228225152

ebwtTotSz: 228225152

color: 0

reverse: 1

Total time for backward call to driver() for mirror index: 00:15:05

Sorting block time: 00:13:49

Returning block of 684675329 for bucket 1

Exited Ebwt loop

fchr[A]: 0

fchr[C]: 223134775

fchr[G]: 223134775

fchr[T]: 342402452

fchr[$]: 684675328

Exiting Ebwt::buildToDisk()

Returning from initFromVector

Wrote 232427948 bytes to primary EBWT file: BS_CT.rev.1.bt2

Wrote 171168840 bytes to secondary EBWT file: BS_CT.rev.2.bt2

Re-opening _in1 and _in2 as input streams

Returning from Ebwt constructor

Headers:

len: 684675328

bwtLen: 684675329

sz: 171168832

bwtSz: 171168833

lineRate: 6

offRate: 4

offMask: 0xfffffff0

ftabChars: 10

eftabLen: 20

eftabSz: 80

ftabLen: 1048577

ftabSz: 4194308

offsLen: 42792209

offsSz: 171168836

lineSz: 64

sideSz: 64

sideBwtSz: 48

sideBwtLen: 192

numSides: 3566018

numLines: 3566018

ebwtTotLen: 228225152

ebwtTotSz: 228225152

color: 0

reverse: 1

#Total time for backward call to driver() for mirror index: 00:16:48



Written on September 18, 2018